You are here: Home Recent Funding Genetic Polymorphisms in the Human Xeroderma Pigmentosum Group A Gene

Genetic Polymorphisms in the Human Xeroderma Pigmentosum Group A Gene

The specific aim of the proposal was to determine polymorphisms in the XPA DNA binding domain present in the normal population.

Methods development:

Methods were developed to amplify XPA gene fragments from small quantitites of genomic DNA isolated from pathological specimens, and to sequence the PCR products using Big Dye terminator technology and the Perkin Elmer Model 310 sequencer.

Fluorescent micro-DNA assay:
During the course of methods development, it was necessary to determine the yield of DNA fragments generated by PCR so that the template concentration could be adjusted in the sequencing reactions. A procedure using SybrGold dye and the Molecular Dynamics Storm Imaging system was developed to assay DNA concentrations in samples from the PCR amplification reactions.

Results:

The results are summarized in Table 1. The majority of the DNA samples functioned well as templates for PCR amplification of fragments containing XPA exon 4, 5 or 6. We were most successful amplifying exon 5. Amplification of exon 6 proved to be more problematic. The high frequency of failed PCR amplifications of exon 6 from DNA samples that functioned as templates for the exon 4 and exon 5 amplifications is difficult to explain. The exon 6 PCR primers were reliable in previous studies and worked well on most of these DNA samples.We tried several times to amplify exon 6 from these DNAs with no success. It is unlikely that these DNAs all contain a deletion of exon 6 or polymorphisms that prevent the PCR oligonucleotide primers from hybridizing.

The results of the sequencing were quite surprising and suggest that XPA may be a very stable region in the genome. We observed 3 polymorphisms within the protein coding sequences of exon 6. All 3 single nucleotide polymorphisms (SNPs) cause missense changes in XPA and are listed in Table 1. We observed no polymorphisms within the protein coding sequences of XPA exons 4 or 5. We found 4 novel SNPs in intron 4. One SNP was present in two DNA samples. The intron 4 SNPs appeared at 17, 94, and 154 nucleotides 5’ of the intron 4/exon 5 junction and at 34 nucleotides 3’ of the exon 4/intron 4 junction. None of these polymorphic sequences would be expected to create alternative splice junctions that could compete with the wild type splice sequence and thereby reduce the amount of XPA mRNA. Thus, we believe these intron SNPs are likely to have no impact on DNA repair proficiciency.

A candidate polymorphism in XPA exon 5 appeared in a number of sequences.The putative polymorphism would encode a missense change in the DNA contact region of XPA. However, attempts to verify this candidate polymorphism by restriction analyses were unsuccessful. These results suggested that the putative polymorphism was a sequencing artifact.

Table 1. Results of polymorphism search in XPA exons 4, 5 and 6.

  XPA exon 4 XPA exon 5 XPA exon 6
PCR Fragment size 340bp 357bp 338bp
PCR primer sequences: sense
anti-sense
aagttgctgggctatttg
gtttttccacactctgtaag
cagtttcataggtttagataga
aaaacacaatccttca
agcttgatggagtcggat
ggttccattcatctatgaagatcttgc
# DNAs successfully amplified 147 170 120
# DNAs no amplification 35 12 62
# PCR products successfully sequenced 129 146 103
# polymorphic sequences 1 4 3
# polymorphisms that appeared > 1 time 0 1 0
observed SNP frequency (% chromosomes) < 0.4% 1.7 % 1.5%
Observed SNP/base pair 0.0016% 0.0067% 0.006%
Nucleotides sequenced/fragment 228bp sense (60)
260bp anti (69)
255bp anti (146) 242bp anti (103)
polymorphic variants intron 4: +34 nt 3’ exon 4 intron 4:
T(-154)G
A(-94)C
T(-17)G
G>A: R228Q
G>T: V234L
C>G: L251V

Conclusions:

We conclude that the portion of XPA encoding the DNA interaction domain of XPA is an extraordinarily stable region of the genome. The stability may reflect the key role that XPA plays in nucleotide excision repair.

Future Plans:

We are preparing a manuscript to report these results. Dr. Mellon’s laboratory has completed preliminary functional studies on the impact of two of the exon 6 polymorphisms on repair of UV photoproducts. Her laboratory previously indentified these SNPs by single strand conformation polymorphism (SSCP) analyses. We intend to examine the impact of the exon 6 polymorphisms on repair of benzo[a]pyrene induced DNA damage. If these results show that the polymorphic proteins alter repair capacity, we will submit a grant application to study these variants further and to determine whether persons carrying these genetic variants are more susceptible to environmentally induced diseases.

Document Actions
Personal tools